Services and Fees
Next Generation Library Preparation
| Library Type | Max number of samples that can be multiplexed in one lane | WVU Users | Non-WVU Users |
| Each Sample | Each Sample | ||
| Bead Purification | NA | $2 | $3 |
| Custom Build | NA | $1 | $1 |
| KAPA Hyper DNA Library Prep | NA | $75 | $105 |
| KAPA PCR Reaction | NA | $2.50 | $3.75 |
| Metagenomic Primer Aliquot (50uL at 5uM) | NA | $2 | $3 |
| Illumina compatible gDNA | >400 | $75 | $105 |
| Illumina compatible Stranded mRNA | 24 | $80 | $150 |
| Illumina compatible Small RNA | 48 | $150 | $250 |
| Nextera XT small genome DNA Library Prep
|
96 | $70 | $110 |
| Script Seq Epidemiology RNA Library Prep
|
24 | $225 | $315 |
| Script Seq Gold Bacterial RNA Library Prep
|
24 | $225 | $315 |
MiSeq sequencing
Run Type |
Length |
WVU User |
Non-WVU User |
| V2 Chemistry |
|
|
|
| Paired-end 150bp Micro
(2-4 million clusters) |
150bp | $525 | $750 |
| Paired-end 150bp Nano (600k-1million clusters) | 150bp | $375 | $550 |
| Paired-end 250bp Nano
(600k-1million clusters) |
250bp | $460 | $640 |
| Single-end 50bp
(~10million clusters) |
50bp | $830 | $1,220 |
| Paired-end 150bp
(~10million clusters) |
150bp | $1,300 | $1,750 |
| Paired-end 250bp
(~10million clusters) |
250bp | $1,420 | $1,950 |
| V3 Chemistry |
|
|
|
| Paired-end 75bp
(~20million clusters) |
75bp | $1,150 | $1,650 |
| Paired-end 300bp
(~20million clusters) |
300bp | $1,850 | $2,550 |
We have a collaborative relationship with the
Marshall University Genomics Core Facility which provides Illumina HiSeq
2500 sequencing for libraries prepared in our facility. Please inquire for pricing.
Other Sequencing Services
| Service Level |
Single Sample*
(WVU User/Non-WVU User) |
Group of 16 Samples** (WVU User/Non-WVU User) | Group of 96 Samples** (WVU User/Non-WVU User) |
| Full Service Sanger Sequencing - includes sequencing reaction†, cleanup, and run on 3130xl | $7.50/$12.00 | $90/$125 | $380/$550 |
| Partial Service Sanger Sequencing - cleanup and reaction performed by user | $3.00/$5.00 | $25/$32 | $90/$115 |
| Fragment Analysis Samples on 3130xl - User performs reaction and provides size standard | $3.00/$5.00 | $25/$32 | $90/$115 |
|
RNA Nano (50-500 ng/uL) 6000 Analysis on Agilent 2100 Bioanalyzer‡
(12 sample chip) |
$60/$75 | ||
|
RNA Pico (0.5-5 ng/uL) 6000 Analysis on Agilent 2100
Bioanalyzer‡
(12 sample chip) |
$60/$75 |
|
|
|
Bioanalyzer High Sensitivity (0.5-5 ng/uL) DNA Chip‡
(11 sample chip) |
$75/$125 | ||
| Covaris DNA shearing | $8/$10 | ||
|
Illumina Library QC via qPCR
(1-12 samples) |
$100/$150 | ||
|
Qubit Quantification
Quantify dsDNA or RNA |
$3/$5 |
|
|
| DNA Size Selection on Blue Pippen | $60/$120 |
** We ask that you leave one well available for the inclusion of a positive control.
† Assumes M13 or other standard primers. Custom primers should be provided by individual researchers. Submission conditions vary depending on sample type. Please contact the lab manager for details.
‡ Please provide at least one week advance notice for use of the BioAnalyzer to allow time for ordering, if necessary.
Available Primers
| Primer Name | Sequence |
| SP6_Promoter | TACGATTTAGGTGACACTATAG |
| BGH_Reverse | TAGAAGGCACAGTCGAGG |
| CMV_Forward | CGCAAATGGGCGGTAGGCGTG |
| T3_Promoter | AATTAACCCTCACTAAAGGG |
| T7_Promoter | TAATACGACTCACTATAGGG |
| M13_Forward (-20) | GTAAAACGACGGCCAGT |
| M13_Reverse (-27) | CAGGAAACAGCTATGAC |
| Luc_F | AGTCAAGTAACAACCGCGA |
| LKO.15-Human U6 promoter | GACTATCATATGCTTACCGT |
| SV40pA-R | GAAATTTGTGATGCTATTGC |
| TRIPZ/GIPZ_HairpinSeq | GTTTGTTTGAATGAGGCTTC |
| pGEX_F | GGGCTGGCAAGCCACGTTTGGTG |
| pGEX_R | CCGGGAGCTGCATGTGTCAGAGG |
| CMV_Prom_F | TAGGCGTGTACGGTGGGAG |
Bioinformatics
All bioinformatics services are charged at an hourly rate of $30/hr for WVU users
and $35/hr for external users. This time includes just the time a bioinformatician
is actively engaged with your data. There is currently no charge for computational time.
Below is a list of common tasks and an estimate for how long they will take.
Note that this is by no means a comprehensive list of available services; it's
just a few easily quantifiable tasks. A few things we can also help with include:
- Experiment design
- Grant writing
- Large data sets
- Mining public databases
- Automation of repetitive tasks
- Publication quality figures
- Interactive visualizations
- Custom analyses
- Training
| Service |
Estimate
(hours) |
| RNA-seq | |
| With reference genome in Ensembl, one comparison, identified samples, less than 16 samples | 6 |
| Extra Comparisons | + 1 |
| Without a reference | 20-40 |
| Metagenomics | |
| 16S Metagenomics: classify strains, PCoA, rarefaction, diversity | 5 |
| Fungal ITS: classify strains, PCoA, rarefaction, diversity | 5 |
| Identify significantly different species | + 2 |
All prices subject to change
Last updated March 2018.